View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5828-3 (Length: 143)
Name: Solexa-NF5828-3
Description: NF5828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5828-3 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 127; Significance: 6e-66; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 127; E-Value: 6e-66
Query Start/End: Original strand, 1 - 143
Target Start/End: Complemental strand, 3499039 - 3498897
Alignment:
| Q |
1 |
agcatagggatgtacgtgtatgatttctctttttatatttgagatgaaggctgatgccatattattcaactgtcttagtgactggctgatgccatattat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3499039 |
agcatagggatgtacgtgtatgatttctctttttatatttgagatgaaggctgatgccatattattcagctgtcttagtgactggctgatgccatattat |
3498940 |
T |
|
| Q |
101 |
tcaaatctcataccatgatgttggttgtgacatttatgactga |
143 |
Q |
| |
|
|||||||||||| ||||||| |||||| ||||||||||||||| |
|
|
| T |
3498939 |
tcaaatctcatatcatgatgctggttgcgacatttatgactga |
3498897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 59; Significance: 2e-25; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 59; E-Value: 2e-25
Query Start/End: Original strand, 20 - 94
Target Start/End: Complemental strand, 2355119 - 2355045
Alignment:
| Q |
20 |
atgatttctctttttatatttgagatgaaggctgatgccatattattcaactgtcttagtgactggctgatgcca |
94 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
2355119 |
atgatttctctttttatatttgagatgaatgttgatgccatattattcaactgtcttagtgattggccgatgcca |
2355045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 8e-19
Query Start/End: Original strand, 20 - 94
Target Start/End: Original strand, 2354145 - 2354222
Alignment:
| Q |
20 |
atgatttctctttttatatttgagatgaaggctgatgcca---tattattcaactgtcttagtgactggctgatgcca |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||| || ||||||| | |||||||||||| |
|
|
| T |
2354145 |
atgatttctctttttatatttgagatgaaggctgatgccatattattattcagctttcttagttattggctgatgcca |
2354222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University