View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5828-6 (Length: 134)
Name: Solexa-NF5828-6
Description: NF5828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5828-6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 111; Significance: 2e-56; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 111; E-Value: 2e-56
Query Start/End: Original strand, 2 - 131
Target Start/End: Complemental strand, 43589215 - 43589086
Alignment:
| Q |
2 |
ccacgaggtcataaagaatttgatgaagggcataaataaatagagatatagcatataggacccctcccctcacaatcacatggcttgtcctttttcttaa |
101 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
43589215 |
ccacgaggacataaagaatttgatgaagggcataaataaatagagatatagcatataggacccctcccctcacaatcacatggcttgtcc-ttttcttaa |
43589117 |
T |
|
| Q |
102 |
taacctccctgccaata-ttttacttgctct |
131 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |
|
|
| T |
43589116 |
taacctccctgccaatatttttacttgctct |
43589086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University