View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5829-1 (Length: 286)
Name: Solexa-NF5829-1
Description: NF5829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5829-1 |
 | |
|
| [»] scaffold0370 (1 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 273; Significance: 1e-152; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 8 - 284
Target Start/End: Complemental strand, 38638259 - 38637983
Alignment:
| Q |
8 |
ctgaagtataagttcatgacctttatcgttggaacatctgagacaatgacttgatcgatgtcaatttgtcaaaacaaatgacactagtaagtgcaattat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
38638259 |
ctgaagtataagttcatgacctttatcgttggaacatctgagacaatgacttgatcgatgtcaatttgtcaaaacaaatgacactagtaattgcaattat |
38638160 |
T |
|
| Q |
108 |
atcaaattcatagattatggttttaaaaacattacctcctcgtgatgcaattttttcaatttcaaaatcctttgatatgcttcatcctttttcttatgct |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38638159 |
atcaaattcatagattatggttttaaaaacattacctcctcgtgatgcaattttttcaatttcaaaatcctttgatatgcttcatcctttttcttatgct |
38638060 |
T |
|
| Q |
208 |
tctctgtcaatttttctctcaaagaatataattctctgtttatagcttctagttctttcatatcatgtctacctttg |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38638059 |
tctctgtcaatttttctctcaaagaatataattctctgtttatagcttctagttctttcatatcatgtctacctttg |
38637983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 139 - 277
Target Start/End: Complemental strand, 38634082 - 38633944
Alignment:
| Q |
139 |
ttacctcctcgtgatgcaattttttcaatttcaaaatcctttgatatgcttcatcctttttcttatgcttctctgtcaatttttctctcaaagaatataa |
238 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||||||||||||||||||||| ||||||||||||| |||||||| |||||| || ||||||||||||| |
|
|
| T |
38634082 |
ttacctcctcatgatgcaagtttttcaattttaaaatcctttgatatgcttcaccctttttcttatgattctctgttaattttgctttcaaagaatataa |
38633983 |
T |
|
| Q |
239 |
ttctctgtttatagcttctagttctttcatatcatgtct |
277 |
Q |
| |
|
||||| ||||| |||||||||||||||| | ||||||| |
|
|
| T |
38633982 |
ttctccatttatggcttctagttctttcacaccatgtct |
38633944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 159 - 240
Target Start/End: Complemental strand, 38690730 - 38690649
Alignment:
| Q |
159 |
tttttcaatttcaaaatcctttgatatgcttcatcctttttcttatgcttctctgtcaatttttctctcaaagaatataatt |
240 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| ||||||||||||||| |||||||| | |||||||||||||||| |
|
|
| T |
38690730 |
tttttcaatttgaaaatcctttgatatgcttcatccttattcttatgcttctctatcaattttgcactcaaagaatataatt |
38690649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 140 - 243
Target Start/End: Original strand, 45335472 - 45335575
Alignment:
| Q |
140 |
tacctcctcgtgatgcaattttttcaatttcaaaatcctttgatatgcttcatcctttttcttatgcttctctgtcaatttttctctcaaagaatataat |
239 |
Q |
| |
|
||||||||| |||||||| |||||| |||| ||||| ||||||||||||||| ||||||||||||| |||||| |||| |||||||||||| |||||| | |
|
|
| T |
45335472 |
tacctcctcatgatgcaaatttttcgattttaaaattctttgatatgcttcaccctttttcttatgattctctttcaacttttctctcaaataatatagt |
45335571 |
T |
|
| Q |
240 |
tctc |
243 |
Q |
| |
|
|||| |
|
|
| T |
45335572 |
tctc |
45335575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: scaffold0370
Description:
Target: scaffold0370; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 161 - 258
Target Start/End: Complemental strand, 13167 - 13070
Alignment:
| Q |
161 |
tttcaatttcaaaatcctttgatatgcttcatcctttttcttatgcttctctgtcaatttttctctcaaagaatataattctctgtttatagcttcta |
258 |
Q |
| |
|
||||||||||||||||||||| | |||||||| |||||| |||| ||||| |||||||||||||||| |||||||||| || |||||| ||||||| |
|
|
| T |
13167 |
tttcaatttcaaaatcctttgctttgcttcatactttttgttatacttctgattcaatttttctctcaatgaatataattttccgtttatggcttcta |
13070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 48 - 90
Target Start/End: Complemental strand, 10434149 - 10434107
Alignment:
| Q |
48 |
agacaatgacttgatcgatgtcaatttgtcaaaacaaatgaca |
90 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
10434149 |
agacaatgacttgatcgatgtcaatttgacaaaagcaatgaca |
10434107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University