View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5829-10 (Length: 184)
Name: Solexa-NF5829-10
Description: NF5829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5829-10 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 127; Significance: 8e-66; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 127; E-Value: 8e-66
Query Start/End: Original strand, 7 - 184
Target Start/End: Complemental strand, 39557457 - 39557279
Alignment:
| Q |
7 |
accttgctatctagcagcctat--cttttacatgtttgtcttcttgttgtgtcaatccaaatcgtgannnnnnnnnnccacctcgagggacaaggttgtt |
104 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
39557457 |
accttgctatctagcagcctatatcttttacatgtttgtcttcttgttgtgtcaatccaaatcgtgatgttttttttc-acctcgagggacaaggttgtt |
39557359 |
T |
 |
| Q |
105 |
tggaggttaattagacgtaggagtttgattgataaagagcttatggtcgaaattaattataatgctaatatatagagatc |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39557358 |
tggaggttaattagacgtaggagtttgattgataaagagcttatggttgaaattaattataatgctaatatatagagatc |
39557279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University