View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5829-12 (Length: 141)
Name: Solexa-NF5829-12
Description: NF5829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5829-12 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 137; Significance: 6e-72; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 137; E-Value: 6e-72
Query Start/End: Original strand, 1 - 141
Target Start/End: Complemental strand, 34862346 - 34862206
Alignment:
| Q |
1 |
cagagacaataatgtgttcattttgacttggttgacttccacctgatatttgtgaaagcatgtactttggaggacctcttaagtcttcaaatagagggcc |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34862346 |
cagagacaataatgtggtcattttgacttggttgacttccacctgatatttgtgaaagcatgtactttggaggacctcttaagtcttcaaatagagggcc |
34862247 |
T |
|
| Q |
101 |
aaatatagttagataaacagatttagctttctctttccatg |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34862246 |
aaatatagttagataaacagatttagctttctctttccatg |
34862206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University