View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5829-13 (Length: 141)
Name: Solexa-NF5829-13
Description: NF5829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5829-13 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 37; Significance: 0.000000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 89 - 141
Target Start/End: Complemental strand, 24799246 - 24799194
Alignment:
| Q |
89 |
tgtattggaattcgaaacaaccaattttaatcagaaagtttctagttgcttat |
141 |
Q |
| |
|
||||||| ||| |||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
24799246 |
tgtattgaaatctgaaacatccaattttaatcagaaagtttctagttgcttat |
24799194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University