View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5829-2 (Length: 248)
Name: Solexa-NF5829-2
Description: NF5829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5829-2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 5 - 228
Target Start/End: Original strand, 24315885 - 24316106
Alignment:
| Q |
5 |
caagaacaccattaaccatattcgctttaagctcttgaaggttaccatcatcaggaatcttaaacctgctcatgaaattaccactctccagtcactaacc |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | |||||||| |
|
|
| T |
24315885 |
caagaacaccattaaccatattcgctttaagctcttgaaggttaccatcatcaggaatcttaaacctactcatgaaattaccactctcaa--cactaacc |
24315982 |
T |
|
| Q |
105 |
tgaagcattctctcatcttgaagctcaatcaacacatcttcgtttgtgaaaccaggaagcaccaccttccaaatatgagctctcggtgtctctctccaat |
204 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24315983 |
tgaagcattctctcatcttgaagctcaacaaacacatcttcgtttgtgaaaccaggaagcaccaccttccaaatatgagctctcggtgtctctctccaat |
24316082 |
T |
|
| Q |
205 |
ccatacgggtgtttagggatgatc |
228 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
24316083 |
ccatacgggtgtttagggatgatc |
24316106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University