View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5829-24 (Length: 125)
Name: Solexa-NF5829-24
Description: NF5829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5829-24 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 102; Significance: 4e-51; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 102; E-Value: 4e-51
Query Start/End: Original strand, 12 - 125
Target Start/End: Complemental strand, 42981057 - 42980944
Alignment:
| Q |
12 |
atacatacattcacgcatccttcatccatccaacatacaattcaattacaaagaaattcctttctatctccgttttgctagctacttctactgagtagtg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||| |||||||||| |
|
|
| T |
42981057 |
atacatacattcacgcatccttcatccatccaacatacaattcaattacaaagaaattcctttctatctccgttttactagctatttcttctgagtagtg |
42980958 |
T |
 |
| Q |
112 |
atatgggttcttct |
125 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
42980957 |
atatgggttcttct |
42980944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University