View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5829-26 (Length: 116)
Name: Solexa-NF5829-26
Description: NF5829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5829-26 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 53; Significance: 7e-22; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 53; E-Value: 7e-22
Query Start/End: Original strand, 56 - 116
Target Start/End: Original strand, 21640604 - 21640664
Alignment:
| Q |
56 |
tgactaattaatatctaggaaatgctgccttaccattattccaccaataccatacctttat |
116 |
Q |
| |
|
|||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
21640604 |
tgactacttaatatctaggaaatgctgcgttaccattattccaccaataccatacctttat |
21640664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University