View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5829-32 (Length: 51)
Name: Solexa-NF5829-32
Description: NF5829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5829-32 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 33; Significance: 0.0000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.0000000002
Query Start/End: Original strand, 19 - 51
Target Start/End: Original strand, 4692738 - 4692770
Alignment:
| Q |
19 |
gatactacattccgcaaatgaaaagcaaggatc |
51 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
4692738 |
gatactacattccgcaaatgaaaagcaaggatc |
4692770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University