View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5829-5 (Length: 226)
Name: Solexa-NF5829-5
Description: NF5829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5829-5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 11 - 224
Target Start/End: Original strand, 51104683 - 51104897
Alignment:
| Q |
11 |
tctgcttgggacctcatttggagcttagttactgaacattatttattaggatttatttctatgaatggcatctattagaagaaccttgtctc-tgttcct |
109 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |||||||||||| || |||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
51104683 |
tctgcttgggacctcatttggagctgagttacttaacattatttatcagtatttatttctatgaatggcatctattagaagaaccttgtctcctgttcct |
51104782 |
T |
|
| Q |
110 |
ccacccgcaactgcagcaaatgtagatgtctgttcagtatcttccccgttgtctaagtcctcacctagcccccagaagtttgttccatcctatggatttt |
209 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
51104783 |
cgacccgcaactgcagcaaatgtagatgtctgttcagtatcttccccgttgtctaagtcctcacctagcccccagaagttttttccatcctatggatttt |
51104882 |
T |
|
| Q |
210 |
taccttcttcattca |
224 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
51104883 |
taccttcttcattca |
51104897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University