View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5829-6 (Length: 221)
Name: Solexa-NF5829-6
Description: NF5829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5829-6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 8 - 136
Target Start/End: Original strand, 7342373 - 7342503
Alignment:
| Q |
8 |
gtatgtagctgcaatttataacttgcagttaaagttttaaaaaacgatttataactgtaatttagtctatcatattctg--nnnnnnnnnnnnaatgatt |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7342373 |
gtatgtagctgcaatttataacttgcagttaaagttttaaaaaacgatttataactgtaatttagtctatcatattctgtttttgttttttttaatgatt |
7342472 |
T |
|
| Q |
106 |
attttatatatagactttggatggtgttggt |
136 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |
|
|
| T |
7342473 |
attttatatatagactttggatggttttggt |
7342503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 55; Significance: 9e-23; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 132 - 206
Target Start/End: Complemental strand, 8754540 - 8754466
Alignment:
| Q |
132 |
ttggttggatgaggcggcttcccttcttcattgcaagttgggtcgtttacttatcctctatttggagttgcctat |
206 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||| |||||| ||||||| ||||||||| |
|
|
| T |
8754540 |
ttggttggccgaggcggcttcccttcttcattgcaagttgggtcgtttacctatcctttatttggggttgcctat |
8754466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 53; Significance: 1e-21; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 132 - 196
Target Start/End: Complemental strand, 41769167 - 41769103
Alignment:
| Q |
132 |
ttggttggatgaggcggcttcccttcttcattgcaagttgggtcgtttacttatcctctatttgg |
196 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
41769167 |
ttggttggtcgaggcggcttcccttcttcattgcaagttgggtcgtttacctatcctctatttgg |
41769103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 132 - 202
Target Start/End: Original strand, 11467930 - 11468000
Alignment:
| Q |
132 |
ttggttggatgaggcggcttcccttcttcattgcaagttgggtcgtttacttatcctctatttggagttgc |
202 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||| |||| | |||||||||||||||| ||| ||||| |
|
|
| T |
11467930 |
ttggttggccgaggcggcttatcttcttcattgcaagatgggccatttacttatcctctatctggggttgc |
11468000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University