View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5829-9 (Length: 181)
Name: Solexa-NF5829-9
Description: NF5829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5829-9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 70; Significance: 8e-32; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 70; E-Value: 8e-32
Query Start/End: Original strand, 104 - 177
Target Start/End: Original strand, 12136444 - 12136517
Alignment:
| Q |
104 |
ttgggctgggtgcttttgaaacttacttgatgggctttgttgaaatacaccaaccctttgatcctatgcttctc |
177 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12136444 |
ttgggttgggtgcttttgaaacttacttgatgggctttgttgaaatacaccaaccctttgatcctatgcttctc |
12136517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 66 - 105
Target Start/End: Complemental strand, 1517004 - 1516965
Alignment:
| Q |
66 |
gggtacaatgaagaccatttcctgatcatgtataaccttt |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1517004 |
gggtacaatgaagaccatttcctgatcatgtataatcttt |
1516965 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 6 - 43
Target Start/End: Complemental strand, 1517064 - 1517027
Alignment:
| Q |
6 |
cattaattagagatttgatgctgatgaagaccatttcc |
43 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
1517064 |
cattaattagagatttgatgccgatgaagaccatttcc |
1517027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University