View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5830-17 (Length: 73)
Name: Solexa-NF5830-17
Description: NF5830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5830-17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 49; Significance: 9e-20; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 49; E-Value: 9e-20
Query Start/End: Original strand, 8 - 64
Target Start/End: Original strand, 8427049 - 8427105
Alignment:
| Q |
8 |
aaacgatacacacacatatcagaaattttgttactttgttagtcctccccctatgct |
64 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
8427049 |
aaacgatacacacacatatcagaaattttgttactttgttagtccttcccctttgct |
8427105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University