View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5831-1 (Length: 212)
Name: Solexa-NF5831-1
Description: NF5831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5831-1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 8 - 209
Target Start/End: Original strand, 38574510 - 38574710
Alignment:
| Q |
8 |
ggttgaaaccattttgtttttgccaggacaaaagcacatgtctcatcccgaagacacatatctataccaacttcattatcatgattagcgaaaatgtgtc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||| |||||| ||| |
|
|
| T |
38574510 |
ggttgaaaccattttgtttttgccaggacaaaagcacatgtctcatcc-gaatacacatatctataccaacttcattatcatgattagcaaaaatgcgtc |
38574608 |
T |
|
| Q |
108 |
aatattgcatttcattcttcctgcaatcggtttgacccatttgaagggtcttgatggcttaccttcacttccatgatttgtgcgagccttatgtgttgct |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38574609 |
aatattgcatttcattcttcctgcaatcggtttgacccatttgaagggtcttgatggcttaccttcacttccatgatttgtgcgagccttatgtgttgct |
38574708 |
T |
|
| Q |
208 |
tc |
209 |
Q |
| |
|
|| |
|
|
| T |
38574709 |
tc |
38574710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 69 - 122
Target Start/End: Original strand, 16907094 - 16907148
Alignment:
| Q |
69 |
ctataccaacttcattatcatgattagcgaaa-atgtgtcaatattgcatttcat |
122 |
Q |
| |
|
|||||||||||| |||||||||||||| |||| ||| |||||||||| ||||||| |
|
|
| T |
16907094 |
ctataccaactttattatcatgattagggaaagatgcgtcaatattgtatttcat |
16907148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University