View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5831-11 (Length: 146)
Name: Solexa-NF5831-11
Description: NF5831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5831-11 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 131; Significance: 3e-68; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 131; E-Value: 3e-68
Query Start/End: Original strand, 8 - 146
Target Start/End: Complemental strand, 35042749 - 35042611
Alignment:
| Q |
8 |
gagatgaagtaggttcacctgccttgtccaacggagagaaatcacctgaaacacctggatgttgtcggagcttgtccaaaatgaaagtcacagatcaaca |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
35042749 |
gagaagaagtaggttcacctgccttgtccaacggagagaaatcacctgaaacacctggatgttgtcggagcttgtccaaaatgaaagtcagagatcaaca |
35042650 |
T |
|
| Q |
108 |
tgatgcccttgccgttagttcccgaaaaggaattttgag |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35042649 |
tgatgcccttgccgttagttcccgaaaaggaattttgag |
35042611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University