View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5831-12 (Length: 144)
Name: Solexa-NF5831-12
Description: NF5831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5831-12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 98; Significance: 1e-48; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 98; E-Value: 1e-48
Query Start/End: Original strand, 8 - 109
Target Start/End: Original strand, 52392179 - 52392280
Alignment:
| Q |
8 |
cgaggatgaacaccttacagctatttccaatttatcaaggactattcaggtttcactttgtgattcacatatctatcaactgttttgtttatgtgctaat |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
52392179 |
cgaggatgaacaccttacagctatttccaatttatcaaggactattcaggtttcactttgtgattcacatatctaccaactgttttgtttatgtgctaat |
52392278 |
T |
 |
| Q |
108 |
ga |
109 |
Q |
| |
|
|| |
|
|
| T |
52392279 |
ga |
52392280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 9 - 60
Target Start/End: Original strand, 7116330 - 7116381
Alignment:
| Q |
9 |
gaggatgaacaccttacagctatttccaatttatcaaggactattcaggttt |
60 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||| |||| |||||||||||||| |
|
|
| T |
7116330 |
gaggaagaacaccttatagcaatttccaatttgtcaaagactattcaggttt |
7116381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University