View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5831-15 (Length: 141)
Name: Solexa-NF5831-15
Description: NF5831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5831-15 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 95; Significance: 7e-47; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 95; E-Value: 7e-47
Query Start/End: Original strand, 1 - 141
Target Start/End: Original strand, 45460410 - 45460550
Alignment:
| Q |
1 |
agacatggtgaagattggcaacgcaacaagtatgccannnnnnncatttctcttggtgttaattaatgnnnnnnncttgagttattaatcaagagagtag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
45460410 |
agacatggtgaagattggcaacgcaacaagtatgccatttttttcatttctcttggtgttaattaatgtttttttcttgagttattaatcaagagagtag |
45460509 |
T |
|
| Q |
101 |
ctcccatttttgcattaaactagaaaatgaagagaagtctt |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
45460510 |
ctcccatttttgcattaaactagaaaatgaagggaagtctt |
45460550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University