View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5831-19 (Length: 139)
Name: Solexa-NF5831-19
Description: NF5831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5831-19 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 121; Significance: 2e-62; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 121; E-Value: 2e-62
Query Start/End: Original strand, 7 - 139
Target Start/End: Complemental strand, 700625 - 700493
Alignment:
| Q |
7 |
atccttggcgtctgtaagcttaactctctcattcggactttcgattttcatttgcaaacaaactgtctctgcacacttatttccaaactctgcaacttca |
106 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
700625 |
atccttcgcgtctgcaagcttaactctctcattcggactttcgattttcatttgcaaacaaactgtctctgcacacttatttccaaactctggaacttca |
700526 |
T |
|
| Q |
107 |
ataataggcacaatatcaaacggcatcacccat |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
700525 |
ataataggcacaatatcaaacggcatcacccat |
700493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000004
Query Start/End: Original strand, 10 - 139
Target Start/End: Original strand, 23261501 - 23261630
Alignment:
| Q |
10 |
cttggcgtctgtaagcttaactctctcattcggactttcgattttcatttgcaaacaaactgtctctgcacacttatttccaaactctgcaacttcaata |
109 |
Q |
| |
|
|||||| |||| |||||| || |||||||| || || ||||||||| |||| |||||||||||||| ||||| |||||||| | ||||||||| |
|
|
| T |
23261501 |
cttggcttctgcaagcttgtctttctcattctgagatttgattttcatctgcaggcaaactgtctctgcgcacttgtttccaaatggcggaacttcaatg |
23261600 |
T |
|
| Q |
110 |
ataggcacaatatcaaacggcatcacccat |
139 |
Q |
| |
|
|| |||| || |||||||||| ||||||| |
|
|
| T |
23261601 |
atcggcaaaacctcaaacggcaacacccat |
23261630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University