View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5831-21 (Length: 135)
Name: Solexa-NF5831-21
Description: NF5831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5831-21 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 110; Significance: 8e-56; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 110; E-Value: 8e-56
Query Start/End: Original strand, 2 - 135
Target Start/End: Original strand, 26629966 - 26630099
Alignment:
| Q |
2 |
atgaaacaaacagaagagagaaagcaaaactttgttttaaacattcctggtttagagataccttcagtagcaaattcaccaacaaattcacaagtaattt |
101 |
Q |
| |
|
||||||||||||||||||||||||||| | |||||| |||||||||||||||||||||| ||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
26629966 |
atgaaacaaacagaagagagaaagcaagaatttgttgtaaacattcctggtttagagattccttcggtagcaaattcaccaacaatttcacaagtaattt |
26630065 |
T |
|
| Q |
102 |
tccagccatgtcccttccttcgatattcttctta |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
26630066 |
tccagccatgtcccttccttcgatattcttctta |
26630099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University