View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5831-24 (Length: 134)
Name: Solexa-NF5831-24
Description: NF5831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5831-24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 98; Significance: 1e-48; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 98; E-Value: 1e-48
Query Start/End: Original strand, 9 - 121
Target Start/End: Original strand, 36594285 - 36594398
Alignment:
| Q |
9 |
ataggagggactccaattcatataagaaaaattcaaacctgacttttgaattagaagaaattagaattagattcttctccttagaaattagg-aaacaat |
107 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36594285 |
ataggagggactccgattcatataagaaaaattcaaacctcacttttgaattagaagaaattagaattagattcttctccttagaaattaggaaaacaat |
36594384 |
T |
 |
| Q |
108 |
acatcaagtgtaaa |
121 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
36594385 |
acatcaagtgtaaa |
36594398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University