View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5831-25 (Length: 133)
Name: Solexa-NF5831-25
Description: NF5831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5831-25 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 118; Significance: 1e-60; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 118; E-Value: 1e-60
Query Start/End: Original strand, 16 - 133
Target Start/End: Original strand, 4195768 - 4195885
Alignment:
| Q |
16 |
atatattataaatcagaattttctataaaaccatctgcaaataaaagccacgaaagacataaattttggagttagaaatttttgtaaatttttctgaaga |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4195768 |
atatattataaatcagaattttctataaaaccatctgcaaataaaagccacgaaagacataaattttggagttagaaatttttgtaaatttttctgaaga |
4195867 |
T |
 |
| Q |
116 |
taaccaatacatatatga |
133 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
4195868 |
taaccaatacatatatga |
4195885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University