View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5831-26 (Length: 132)
Name: Solexa-NF5831-26
Description: NF5831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5831-26 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 117; Significance: 5e-60; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 117; E-Value: 5e-60
Query Start/End: Original strand, 12 - 132
Target Start/End: Complemental strand, 43091246 - 43091126
Alignment:
| Q |
12 |
gtatgtattaggtagtagtagggtgttggagatggaaaaaggaacaatgttgattcatctaaaaagctatcttttattggttcagctttaatgcataaaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43091246 |
gtatgtattaggtagtagtagggtgttggagatggaaaaaggaacaatgttgattcatctaaaaagctatcttttattggttcagctttaatgcataaaa |
43091147 |
T |
 |
| Q |
112 |
gtaacagaaccatatacagaa |
132 |
Q |
| |
|
||||||||||||||| ||||| |
|
|
| T |
43091146 |
gtaacagaaccatattcagaa |
43091126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University