View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5831-28 (Length: 131)
Name: Solexa-NF5831-28
Description: NF5831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5831-28 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 119; Significance: 3e-61; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 119; E-Value: 3e-61
Query Start/End: Original strand, 1 - 131
Target Start/End: Original strand, 4228504 - 4228634
Alignment:
| Q |
1 |
gagatgaagcataccaggtcacacaaatgcatgtgatccaatggaaatactcccttctccggaggcaccggacggagccctcggttgccaccaaatgcac |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4228504 |
gagaagaagcataccaggtcacacaaatgcatgtgatccaatggaaatactcccttctccggaggcaccggacggagccctcggttgccaccaaatgcac |
4228603 |
T |
|
| Q |
101 |
aacctaattatcacaacagtttcagcaaata |
131 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |
|
|
| T |
4228604 |
cacctaattatcacaacagtttcagaaaata |
4228634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 113; Significance: 1e-57; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 113; E-Value: 1e-57
Query Start/End: Original strand, 1 - 125
Target Start/End: Complemental strand, 52619375 - 52619251
Alignment:
| Q |
1 |
gagatgaagcataccaggtcacacaaatgcatgtgatccaatggaaatactcccttctccggaggcaccggacggagccctcggttgccaccaaatgcac |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52619375 |
gagaagaagcataccaggtcacacaaatgcatgtgatccaatggaaatactcccttctctggaggcaccggacggagccctcggttgccaccaaatgcac |
52619276 |
T |
|
| Q |
101 |
aacctaattatcacaacagtttcag |
125 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
52619275 |
cacctaattatcacaacagtttcag |
52619251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University