View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5831-30 (Length: 130)
Name: Solexa-NF5831-30
Description: NF5831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5831-30 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 120; Significance: 8e-62; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 120; E-Value: 8e-62
Query Start/End: Original strand, 1 - 128
Target Start/End: Complemental strand, 52213867 - 52213740
Alignment:
| Q |
1 |
ctgaaactgcttttttgtttggattttgcaatcatcgtgaggggactgcaaatgtggttggaactcatgatgcagttgttaaagtgattctcaagtagag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52213867 |
ctgaaactgcttttttgtttggattttgcaatcatcgtgaggggactgcaaatgtggttggaactcatgatgcagttgttaaagtgattctcaagtagag |
52213768 |
T |
|
| Q |
101 |
tacattagaaggagtaggcatttattgc |
128 |
Q |
| |
|
||||| ||||||||||| |||||||||| |
|
|
| T |
52213767 |
tacatcagaaggagtagacatttattgc |
52213740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 55; Significance: 5e-23; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 55; E-Value: 5e-23
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 4194021 - 4193967
Alignment:
| Q |
1 |
ctgaaactgcttttttgtttggattttgcaatcatcgtgaggggactgcaaatgt |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4194021 |
ctgaaactgcttttttgtttggattttgcaatcatcgtgaggggactgcaaatgt |
4193967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University