View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5831-32 (Length: 128)
Name: Solexa-NF5831-32
Description: NF5831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5831-32 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 124; Significance: 3e-64; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 124; E-Value: 3e-64
Query Start/End: Original strand, 1 - 128
Target Start/End: Original strand, 699858 - 699985
Alignment:
| Q |
1 |
atgaacccttattttgattcttttgttaggtggcaaatgaggaaattgaagtcattggggaaggttgttaaagatgttaggtatacaattttttcgcctt |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
699858 |
atgaacccttattttgattctttcgttaggtggcaaatgaggaaattgaagtcattggggaaggttgttaaagatgttaggtatacaattttttcgcctt |
699957 |
T |
|
| Q |
101 |
tggatggacaaccgtgtgctgatcatga |
128 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
699958 |
tggatggacaaccgtgtgctgatcatga |
699985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 68; Significance: 8e-31; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 68; E-Value: 8e-31
Query Start/End: Original strand, 1 - 128
Target Start/End: Complemental strand, 23262265 - 23262138
Alignment:
| Q |
1 |
atgaacccttattttgattcttttgttaggtggcaaatgaggaaattgaagtcattggggaaggttgttaaagatgttaggtatacaattttttcgcctt |
100 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||| |||||||| |||||| | | || ||||||||||| ||||||||||||||| |||||||||| | |
|
|
| T |
23262265 |
atgaatccttattttgatgcttttgttaggtggcatatgaggaagttgaaggcgtctggtaaggttgttaaggatgttaggtatacagttttttcgccat |
23262166 |
T |
|
| Q |
101 |
tggatggacaaccgtgtgctgatcatga |
128 |
Q |
| |
|
|||||||||| || ||||| |||||||| |
|
|
| T |
23262165 |
tggatggacagccttgtgcggatcatga |
23262138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University