View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5831-35 (Length: 127)
Name: Solexa-NF5831-35
Description: NF5831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5831-35 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 62; Significance: 3e-27; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 62; E-Value: 3e-27
Query Start/End: Original strand, 42 - 127
Target Start/End: Complemental strand, 26630231 - 26630146
Alignment:
| Q |
42 |
ttgatccatcaaacattgttgactcgttgattgttcattcaacaacttctacaatttggaaactaagcgttagatatgtgaaacta |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| || | ||| ||||| ||||||||||| ||||||||||| |
|
|
| T |
26630231 |
ttgatccatcaaacattgttgactcgttgattgttcattcaacaactcctgcgattaggaaattaagcgttagagatgtgaaacta |
26630146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 8 - 40
Target Start/End: Complemental strand, 26630229 - 26630197
Alignment:
| Q |
8 |
gatccatcaaacattgttgactctttgattgtt |
40 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
26630229 |
gatccatcaaacattgttgactcgttgattgtt |
26630197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University