View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5831-37 (Length: 123)
Name: Solexa-NF5831-37
Description: NF5831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5831-37 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 105; Significance: 7e-53; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 105; E-Value: 7e-53
Query Start/End: Original strand, 8 - 112
Target Start/End: Original strand, 6757207 - 6757311
Alignment:
| Q |
8 |
gaaagatgtatgcttttattttatacttacttatagtttatgctttatcaatggtaaatagtttggtttagggatggaatacaagttttgcgcctttgca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6757207 |
gaaagatgtatgcttttattttatacttacttatagtttatgctttatcaatggtaaatagtttggtttagggatggaatacaagttttgcgcctttgca |
6757306 |
T |
|
| Q |
108 |
ttctt |
112 |
Q |
| |
|
||||| |
|
|
| T |
6757307 |
ttctt |
6757311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 35 - 83
Target Start/End: Complemental strand, 25465699 - 25465651
Alignment:
| Q |
35 |
tacttatagtttatgctttatcaatggtaaatagtttggtttagggatg |
83 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
25465699 |
tactcatagtttatcctttatcaatggtaaatagtttggtttagggatg |
25465651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University