View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5831-39 (Length: 119)
Name: Solexa-NF5831-39
Description: NF5831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5831-39 |
 | |
|
| [»] chr4 (3 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 104; Significance: 3e-52; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 104; E-Value: 3e-52
Query Start/End: Original strand, 8 - 119
Target Start/End: Original strand, 11803115 - 11803226
Alignment:
| Q |
8 |
gcacctccgccataggaattgtactgaacagcttgcataagtttcacagacatatctagttttgttcacttgttttcttttaacaaactattatgttgac |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
11803115 |
gcacctccgccataggaattgtactgaacagcttgcataagtttcacagacatatctagttttgttcacttgttttcttttaacaaactactatgttgac |
11803214 |
T |
|
| Q |
108 |
tattatagtatt |
119 |
Q |
| |
|
||||| |||||| |
|
|
| T |
11803215 |
tattacagtatt |
11803226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 11 - 62
Target Start/End: Original strand, 11843407 - 11843458
Alignment:
| Q |
11 |
cctccgccataggaattgtactgaacagcttgcataagtttcacagacatat |
62 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||||||||| ||| ||||| |
|
|
| T |
11843407 |
cctccgccataggaactgtactgaagagcttgcataagtttcgcagccatat |
11843458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.00000000004
Query Start/End: Original strand, 17 - 51
Target Start/End: Original strand, 11809025 - 11809059
Alignment:
| Q |
17 |
ccataggaattgtactgaacagcttgcataagttt |
51 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
11809025 |
ccataggaattgtactgaacagcttgcataagttt |
11809059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University