View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5831-45 (Length: 110)
Name: Solexa-NF5831-45
Description: NF5831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5831-45 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 79; Significance: 2e-37; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 79; E-Value: 2e-37
Query Start/End: Original strand, 18 - 108
Target Start/End: Original strand, 5103318 - 5103408
Alignment:
| Q |
18 |
accttgcaatgctgtatatgttttgtccactaaccagaaaattccagtgattgatctttgaggacatgatcgtgatgacatcataagaaac |
108 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5103318 |
accttgcaatgctgtacatgttttgtccactaaccagaaagttccagtgattgatcttggaggacatgatcgtgatgacatcataagaaac |
5103408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 49; E-Value: 2e-19
Query Start/End: Original strand, 36 - 108
Target Start/End: Original strand, 5110046 - 5110118
Alignment:
| Q |
36 |
tgttttgtccactaaccagaaaattccagtgattgatctttgaggacatgatcgtgatgacatcataagaaac |
108 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
5110046 |
tgttttgtccactattaagacaattccagtgattgatcttggaggacatgatcgtgatgatatcataagaaac |
5110118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University