View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: Solexa-NF5831-48 (Length: 90)

Name: Solexa-NF5831-48
Description: NF5831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] Solexa-NF5831-48
Solexa-NF5831-48
[»] chr4 (3 HSPs)
chr4 (1-88)||(14494238-14494325)
chr4 (47-85)||(14457071-14457109)
chr4 (42-88)||(14469817-14469863)


Alignment Details
Target: chr4 (Bit Score: 56; Significance: 8e-24; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 56; E-Value: 8e-24
Query Start/End: Original strand, 1 - 88
Target Start/End: Complemental strand, 14494325 - 14494238
Alignment:
1 tattccaaattggttttgggatatttcacctttgctgacacttttaaacatgtctcataatgagttacaaggtcagcttccaaatcca 88  Q
    ||||||||||||||||||||||||| || ||| | ||||| || |||||||||||||||||||||||||||||| |||||||| ||||    
14494325 tattccaaattggttttgggatattacatcttcgttgacaattataaacatgtctcataatgagttacaaggtcggcttccaagtcca 14494238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000003
Query Start/End: Original strand, 47 - 85
Target Start/End: Original strand, 14457071 - 14457109
Alignment:
47 aacatgtctcataatgagttacaaggtcagcttccaaat 85  Q
    |||||||||||||||||||||||||||| ||||||||||    
14457071 aacatgtctcataatgagttacaaggtcggcttccaaat 14457109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.000000007
Query Start/End: Original strand, 42 - 88
Target Start/End: Complemental strand, 14469863 - 14469817
Alignment:
42 ttttaaacatgtctcataatgagttacaaggtcagcttccaaatcca 88  Q
    ||||||||||||| |||||||||||||| |||  |||||||||||||    
14469863 ttttaaacatgtcacataatgagttacagggttggcttccaaatcca 14469817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University