View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: Solexa-NF5831-53 (Length: 61)

Name: Solexa-NF5831-53
Description: NF5831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] Solexa-NF5831-53
Solexa-NF5831-53
[»] chr7 (3 HSPs)
chr7 (15-61)||(6950311-6950357)
chr7 (15-61)||(12334378-12334424)
chr7 (15-61)||(12338565-12338611)
[»] chr4 (1 HSPs)
chr4 (15-61)||(18187732-18187778)
[»] chr3 (2 HSPs)
chr3 (15-61)||(13241151-13241197)
chr3 (15-46)||(54834575-54834606)
[»] chr5 (1 HSPs)
chr5 (15-61)||(39506460-39506506)
[»] chr1 (1 HSPs)
chr1 (15-61)||(42800630-42800676)
[»] scaffold1829 (1 HSPs)
scaffold1829 (15-60)||(965-1010)


Alignment Details
Target: chr7 (Bit Score: 47; Significance: 1e-18; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 47; E-Value: 1e-18
Query Start/End: Original strand, 15 - 61
Target Start/End: Complemental strand, 6950357 - 6950311
Alignment:
Q  15 gatcaatgtcaatactcttttccgcatcatttactaaaatagtgatc 61  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
T  6950357 gatcaatgtcaatactcttttccgcatcatttactaaaatagtgatc 6950311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 47; E-Value: 1e-18
Query Start/End: Original strand, 15 - 61
Target Start/End: Original strand, 12334378 - 12334424
Alignment:
Q  15 gatcaatgtcaatactcttttccgcatcatttactaaaatagtgatc 61  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
T  12334378 gatcaatgtcaatactcttttccgcatcatttactaaaatagtgatc 12334424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 39; E-Value: 0.00000000000007
Query Start/End: Original strand, 15 - 61
Target Start/End: Original strand, 12338565 - 12338611
Alignment:
Q  15 gatcaatgtcaatactcttttccgcatcatttactaaaatagtgatc 61  Q
    |||||||||||||||||||||| ||||||||||||||||||| ||||    
T  12338565 gatcaatgtcaatactcttttctgcatcatttactaaaatagagatc 12338611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 47; Significance: 1e-18; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 47; E-Value: 1e-18
Query Start/End: Original strand, 15 - 61
Target Start/End: Original strand, 18187732 - 18187778
Alignment:
Q  15 gatcaatgtcaatactcttttccgcatcatttactaaaatagtgatc 61  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
T  18187732 gatcaatgtcaatactcttttccgcatcatttactaaaatagtgatc 18187778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 47; Significance: 1e-18; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 47; E-Value: 1e-18
Query Start/End: Original strand, 15 - 61
Target Start/End: Complemental strand, 13241197 - 13241151
Alignment:
Q  15 gatcaatgtcaatactcttttccgcatcatttactaaaatagtgatc 61  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
T  13241197 gatcaatgtcaatactcttttccgcatcatttactaaaatagtgatc 13241151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 15 - 46
Target Start/End: Complemental strand, 54834606 - 54834575
Alignment:
Q  15 gatcaatgtcaatactcttttccgcatcattt 46  Q
    ||||||||||||||||||||||||||||||||    
T  54834606 gatcaatgtcaatactcttttccgcatcattt 54834575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 43; Significance: 3e-16; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 43; E-Value: 3e-16
Query Start/End: Original strand, 15 - 61
Target Start/End: Complemental strand, 39506506 - 39506460
Alignment:
Q  15 gatcaatgtcaatactcttttccgcatcatttactaaaatagtgatc 61  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||    
T  39506506 gatcaatgtcaatactcttttccgcatcatttgctaaaatagtgatc 39506460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 43; Significance: 3e-16; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 43; E-Value: 3e-16
Query Start/End: Original strand, 15 - 61
Target Start/End: Complemental strand, 42800676 - 42800630
Alignment:
Q  15 gatcaatgtcaatactcttttccgcatcatttactaaaatagtgatc 61  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||    
T  42800676 gatcaatgtcaatactcttttccgcatcatttattaaaatagtgatc 42800630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1829 (Bit Score: 34; Significance: 0.00000000007; HSPs: 1)
Name: scaffold1829
Description:

Target: scaffold1829; HSP #1
Raw Score: 34; E-Value: 0.00000000007
Query Start/End: Original strand, 15 - 60
Target Start/End: Complemental strand, 1010 - 965
Alignment:
Q  15 gatcaatgtcaatactcttttccgcatcatttactaaaatagtgat 60  Q
    ||||||||||| ||| ||| ||||||||||||||||||||||||||    
T  1010 gatcaatgtcactacccttctccgcatcatttactaaaatagtgat 965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University