View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5831-6 (Length: 156)
Name: Solexa-NF5831-6
Description: NF5831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5831-6 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 5e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 5e-73
Query Start/End: Original strand, 14 - 156
Target Start/End: Original strand, 4137582 - 4137724
Alignment:
| Q |
14 |
aaatcttggtattccggtctagatgagatcgcgtaccttttttaatctttagtatcgcgaaccaaatcaagattgcataccgttttaaaaatgttggtaa |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4137582 |
aaatcttggtattccggtctagatgagatcgcgtaccttttttaatctttagtatcgcgaaccaaatcaagattgcatacctttttaaaaatgttggtaa |
4137681 |
T |
 |
| Q |
114 |
atccttaaagcaaattataacaaattgaaatcctatcatgaac |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4137682 |
atccttaaagcaaattataacaaattgaaatcctatcatgaac |
4137724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University