View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5831-8 (Length: 153)
Name: Solexa-NF5831-8
Description: NF5831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5831-8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 1 - 149
Target Start/End: Complemental strand, 11804101 - 11803953
Alignment:
| Q |
1 |
acagaaaaagacactgaaaacacaattcaacacaagagattgccattttctagggaaacccattgagttcaacactgcaataaggaattcccattctatc |
100 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
11804101 |
acagaaaaacacactgaaaacacaattcaacacaagagattgccattttctagggaaacccattgagttcaacactgcaataaggaattcccagtctatt |
11804002 |
T |
|
| Q |
101 |
tggtcatatgcttttgtcatatctagtttgatgcttacacacccttttt |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11804001 |
cggtcatatgcttttgtcatatctagtttgatgcttacacacccttttt |
11803953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 104; Significance: 3e-52; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 104; E-Value: 3e-52
Query Start/End: Original strand, 18 - 149
Target Start/End: Complemental strand, 20778590 - 20778459
Alignment:
| Q |
18 |
aaacacaattcaacacaagagattgccattttctagggaaacccattgagttcaacactgcaataaggaattcccattctatctggtcatatgcttttgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
20778590 |
aaacacaattcaacacaagagattgccatttttgagggaaacccattgagttcaacaccgcaataaggaattcccattctatccggtcatatgcttttgc |
20778491 |
T |
|
| Q |
118 |
catatctagtttgatgcttacacacccttttt |
149 |
Q |
| |
|
||||||||||||||||| ||||||||| |||| |
|
|
| T |
20778490 |
catatctagtttgatgcctacacacccctttt |
20778459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University