View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5832-1 (Length: 211)
Name: Solexa-NF5832-1
Description: NF5832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5832-1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 7 - 210
Target Start/End: Original strand, 31097862 - 31098065
Alignment:
| Q |
7 |
acttttttctctgcgatccaaataatgggccatattgttcgaaccataccatctcaatcgtccacaattgtttgagatggcatctcccttaaccttgaat |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31097862 |
acttttttctctgcgatccaaataatgggccatattgttggaaccatactatctcaatcgtccacaattgtttgagatggcatctcccttaaccttgaat |
31097961 |
T |
|
| Q |
107 |
acatcgagtgattcagcattgattaactagtcattaatttctctctttcgtccatgacataacagaagcaggaagtctatcatttgcctcctatgatact |
206 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| | |
|
|
| T |
31097962 |
acatcaagtgattcagcattgattaactggtcattaatttctctctttcgtccatgacataacagaagcaggaagtctatcatttgcctcatatgatatt |
31098061 |
T |
|
| Q |
207 |
gctc |
210 |
Q |
| |
|
|||| |
|
|
| T |
31098062 |
gctc |
31098065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University