View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5832-18 (Length: 130)
Name: Solexa-NF5832-18
Description: NF5832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5832-18 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 90; Significance: 6e-44; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 90; E-Value: 6e-44
Query Start/End: Original strand, 1 - 130
Target Start/End: Original strand, 22557780 - 22557909
Alignment:
| Q |
1 |
gaatgaagaatgtctcaacacgtgatccttttggttgtatcgttgttactttagcatttgattgaatgacgcttattttacctagacaaacattatcaat |
100 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||||||||||||||||||| |||| |||||||||| |||||||||||||||| ||| ||||||||| |
|
|
| T |
22557780 |
gaatgaagaatgtctcaatacatgatccttttggttgtatcgttgttactttaacattcgattgaatgaagcttattttacctagaaaaaaattatcaat |
22557879 |
T |
|
| Q |
101 |
aaaacacagactaattccaatgcatgcaga |
130 |
Q |
| |
|
||||| ||||||||| ||||||||||||| |
|
|
| T |
22557880 |
aaaacctagactaattacaatgcatgcaga |
22557909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University