View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5832-20 (Length: 127)
Name: Solexa-NF5832-20
Description: NF5832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5832-20 |
 | |
|
| [»] chr4 (4 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 113; Significance: 1e-57; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 113; E-Value: 1e-57
Query Start/End: Original strand, 7 - 127
Target Start/End: Complemental strand, 36421022 - 36420902
Alignment:
| Q |
7 |
ataaacctctatgaatgtctgcaaactcaattccaaggtgcaagtataaaccaaaaattacatatttgattaaggaatgcaatcatctttcagcccttta |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
36421022 |
ataaacctctatgaatgtctgcaaactcaattccaaggtgcaagtataaaccaaaatttacatattagattaaggaatgcaatcatctttcagcccttta |
36420923 |
T |
|
| Q |
107 |
gacagctgcaatttattcttc |
127 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
36420922 |
gacagctgcaatttattcttc |
36420902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 10 - 81
Target Start/End: Complemental strand, 36408054 - 36407982
Alignment:
| Q |
10 |
aacctctatgaatgtctgcaaactcaattccaaggtgcaagtataaaccaaaaa-ttacatatttgattaagg |
81 |
Q |
| |
|
|||||||| ||||||| |||||| |||| ||||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
36408054 |
aacctctagaaatgtctacaaactaaatttcaaggtgaaagtataaaccaaaaatttacatatttgattaagg |
36407982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 10 - 81
Target Start/End: Complemental strand, 36413177 - 36413105
Alignment:
| Q |
10 |
aacctctatgaatgtctgcaaactcaattccaaggtgcaagtataaaccaaaaa-ttacatatttgattaagg |
81 |
Q |
| |
|
|||||||| ||||||| |||||| |||| ||||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
36413177 |
aacctctagaaatgtctacaaactaaatttcaaggtgaaagtataaaccaaaaatttacatatttgattaagg |
36413105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 28; E-Value: 0.0000006
Query Start/End: Original strand, 9 - 79
Target Start/End: Complemental strand, 36400602 - 36400531
Alignment:
| Q |
9 |
aaacctctatgaatgtctgcaaactcaattccaaggtgcaagtataaaccaaaaa-ttacatatttgattaa |
79 |
Q |
| |
|
||||||||| |||||||| ||||||||||||| | || || ||| ||| ||||| |||||||||||||||| |
|
|
| T |
36400602 |
aaacctctaggaatgtctacaaactcaattccgatgtaaaactatgaacaaaaaatttacatatttgattaa |
36400531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University