View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5832-21 (Length: 121)
Name: Solexa-NF5832-21
Description: NF5832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5832-21 |
 | |
|
| [»] scaffold0637 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 88; Significance: 9e-43; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 88; E-Value: 9e-43
Query Start/End: Original strand, 1 - 120
Target Start/End: Original strand, 20878171 - 20878290
Alignment:
| Q |
1 |
tgtgtgtgtgattttttaaaggaatatatttttgattgacaagttttggtaagttttcttatgtttcgtacataattccaaggtcgtttccgacaattta |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
20878171 |
tgtgtgtgtaattttttaaaggaatatattcttgattgacaagctttggtaagttttcttatgtttcgtacataattccagggtcgtctccgacaattcg |
20878270 |
T |
|
| Q |
101 |
gaggccccgttataatctct |
120 |
Q |
| |
|
|||||| ||||||||||||| |
|
|
| T |
20878271 |
gaggccacgttataatctct |
20878290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0637 (Bit Score: 40; Significance: 0.00000000000004; HSPs: 1)
Name: scaffold0637
Description:
Target: scaffold0637; HSP #1
Raw Score: 40; E-Value: 0.00000000000004
Query Start/End: Original strand, 19 - 77
Target Start/End: Original strand, 3989 - 4048
Alignment:
| Q |
19 |
aaggaatatatttttgattgacaagttttggtaagttttc-ttatgtttcgtacataatt |
77 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||||| | ||||||||||||||||||| |
|
|
| T |
3989 |
aaggaatatattcttgattgacaagttttggcaagtttcctttatgtttcgtacataatt |
4048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University