View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5832-7 (Length: 144)
Name: Solexa-NF5832-7
Description: NF5832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5832-7 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 87; Significance: 4e-42; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 87; E-Value: 4e-42
Query Start/End: Original strand, 35 - 144
Target Start/End: Original strand, 41772055 - 41772167
Alignment:
| Q |
35 |
agttagttgtggattatatgatgtgtattgggtctagtaggtgaatgtgaggccaattccataatttgtacaaataagag---acatatccatgagtaga |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
41772055 |
agttagttgtggattatatgatgtgtattgggtctagttagtgaatgtgaggccaattccataatttgtacaaataagaggacatatatccatgagtaga |
41772154 |
T |
 |
| Q |
132 |
aagagtttatcat |
144 |
Q |
| |
|
||||||||||||| |
|
|
| T |
41772155 |
aagagtttatcat |
41772167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University