View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5834-14 (Length: 139)
Name: Solexa-NF5834-14
Description: NF5834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5834-14 |
 | |
|
| [»] scaffold0036 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0036 (Bit Score: 134; Significance: 4e-70; HSPs: 1)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 134; E-Value: 4e-70
Query Start/End: Original strand, 2 - 139
Target Start/End: Original strand, 39100 - 39237
Alignment:
| Q |
2 |
agaggaccgaataccatatcaaataaatcatctcctaatcaactgaacaattgaggccatagtgttaatgaagagccacaaatctaatattagaaaactc |
101 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39100 |
agaggacagaataccatatcaaataaatcatctcctaatcaactgaacaattgaggccatagtgttaatgaagagccacaaatctaatattagaaaactc |
39199 |
T |
|
| Q |
102 |
aaacaattagttacgattagacataattattttatttt |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39200 |
aaacaattagttacgattagacataattattttatttt |
39237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University