View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5834-20 (Length: 127)
Name: Solexa-NF5834-20
Description: NF5834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5834-20 |
 | |
|
| [»] scaffold0036 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0036 (Bit Score: 113; Significance: 1e-57; HSPs: 1)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 113; E-Value: 1e-57
Query Start/End: Original strand, 8 - 120
Target Start/End: Complemental strand, 39648 - 39536
Alignment:
| Q |
8 |
ggaggcaggtctttaaacacagatcaaaaggcatagaaatagaaaatagtatatttagaaagcaacgaagagttgcataatgaacaaaattacgagattc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39648 |
ggaggcaggtctttaaacacagatcaaaaggcatagaaatagaaaatagtatatttagaaagcaacgaagagttgcataatgaacaaaattacgagattc |
39549 |
T |
|
| Q |
108 |
tttagtctattgg |
120 |
Q |
| |
|
||||||||||||| |
|
|
| T |
39548 |
tttagtctattgg |
39536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000004
Query Start/End: Original strand, 8 - 58
Target Start/End: Original strand, 26465962 - 26466012
Alignment:
| Q |
8 |
ggaggcaggtctttaaacacagatcaaaaggcatagaaatagaaaatagta |
58 |
Q |
| |
|
||||| ||||||||||||||| |||||||| |||| ||||||||||||||| |
|
|
| T |
26465962 |
ggaggtaggtctttaaacacaaatcaaaagacataaaaatagaaaatagta |
26466012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University