View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5834-23 (Length: 124)
Name: Solexa-NF5834-23
Description: NF5834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5834-23 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 106; Significance: 8e-54; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 106; E-Value: 8e-54
Query Start/End: Original strand, 9 - 124
Target Start/End: Complemental strand, 41541849 - 41541734
Alignment:
| Q |
9 |
agatgaatcgcattttctgctttttgtgattccaatttcattctctttccstccatttctcgccactctttttcttcaagtttcaatctcgttttcatgc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41541849 |
agatgaatcgcattttctgctttttgtgattccaatttcattctctttccctccatttctcgccactctttttcttcaagtttcaatctcgttttcatgg |
41541750 |
T |
|
| Q |
109 |
ttttatgaatttgaac |
124 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
41541749 |
atttatgaatttgaac |
41541734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.0000000000005
Query Start/End: Original strand, 13 - 120
Target Start/End: Complemental strand, 41557587 - 41557480
Alignment:
| Q |
13 |
gaatcgcattttctgctttttgtgattccaatttcattctctttccstccatttctcgccactctttttcttcaagtttcaatctcgttttcatgctttt |
112 |
Q |
| |
|
||||| |||| |||| ||||| ||||||||||||| |||||||||| ||||||| || | |||| |||||||||||| ||| || |||||| | ||| |
|
|
| T |
41557587 |
gaatcccattctctgatttttttgattccaatttctttctctttccctccatttttccagaatcttcttcttcaagttttaatttcattttcaaggattt |
41557488 |
T |
|
| Q |
113 |
atgaattt |
120 |
Q |
| |
|
|||||||| |
|
|
| T |
41557487 |
atgaattt |
41557480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University