View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5834-24 (Length: 122)
Name: Solexa-NF5834-24
Description: NF5834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5834-24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 66; Significance: 1e-29; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 66; E-Value: 1e-29
Query Start/End: Original strand, 8 - 89
Target Start/End: Original strand, 33507699 - 33507780
Alignment:
| Q |
8 |
cataagttcgatttctgactcatatgtatgaaaaaagttttattgagagcagagaaaccactttatatatcccacatggcca |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||| ||||| ||||| |
|
|
| T |
33507699 |
cataagttcgatttctgactcatatgtatgaaaaaggttttattgagaggagagaaaccactttatatattccacacggcca |
33507780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000004
Query Start/End: Original strand, 88 - 122
Target Start/End: Original strand, 33507804 - 33507838
Alignment:
| Q |
88 |
cactattaagcaacggtggaaacttcgtgctaata |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
33507804 |
cactattaagcaacggtggaaacttcgtgctaata |
33507838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University