View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5834-25 (Length: 113)
Name: Solexa-NF5834-25
Description: NF5834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5834-25 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
| [»] scaffold0011 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 91; Significance: 1e-44; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 91; E-Value: 1e-44
Query Start/End: Original strand, 11 - 113
Target Start/End: Original strand, 41540435 - 41540537
Alignment:
| Q |
11 |
cacaatcttttgttctgtttcaattgttgataggtactttccggaaggaattgacatatactttgacaatgttggtggagacatgcttgaagcagccctt |
110 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
41540435 |
cacaatcttttgttctgtttcaatagttgataggtactttcccgaaggaattgacatatactttgacaatgttggtggacacatgcttgaagcagccctt |
41540534 |
T |
|
| Q |
111 |
ctt |
113 |
Q |
| |
|
||| |
|
|
| T |
41540535 |
ctt |
41540537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 37; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 37; E-Value: 0.000000000002
Query Start/End: Original strand, 42 - 106
Target Start/End: Original strand, 231625 - 231689
Alignment:
| Q |
42 |
aggtactttccggaaggaattgacatatactttgacaatgttggtggagacatgcttgaagcagc |
106 |
Q |
| |
|
||||||||||| || |||||||||||||| ||||||||||| || ||||| ||||| |||||||| |
|
|
| T |
231625 |
aggtactttccagatggaattgacatatattttgacaatgtcgggggagaaatgctagaagcagc |
231689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000002; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000002
Query Start/End: Original strand, 41 - 88
Target Start/End: Original strand, 2435835 - 2435882
Alignment:
| Q |
41 |
taggtactttccggaaggaattgacatatactttgacaatgttggtgg |
88 |
Q |
| |
|
|||||||||||| ||||| |||||||| |||||||| ||||||||||| |
|
|
| T |
2435835 |
taggtactttccagaaggcattgacatttactttgagaatgttggtgg |
2435882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 41 - 85
Target Start/End: Original strand, 2432474 - 2432518
Alignment:
| Q |
41 |
taggtactttccggaaggaattgacatatactttgacaatgttgg |
85 |
Q |
| |
|
|||||||||||| ||||| |||||||| |||||||| |||||||| |
|
|
| T |
2432474 |
taggtactttccagaaggcattgacatttactttgagaatgttgg |
2432518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 41 - 85
Target Start/End: Complemental strand, 2516520 - 2516476
Alignment:
| Q |
41 |
taggtactttccggaaggaattgacatatactttgacaatgttgg |
85 |
Q |
| |
|
|||||||||||| ||||| |||||||| |||||||| |||||||| |
|
|
| T |
2516520 |
taggtactttccagaaggcattgacatttactttgagaatgttgg |
2516476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University