View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5834-26 (Length: 109)
Name: Solexa-NF5834-26
Description: NF5834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5834-26 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 86; Significance: 1e-41; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 86; E-Value: 1e-41
Query Start/End: Original strand, 4 - 109
Target Start/End: Original strand, 4021960 - 4022065
Alignment:
| Q |
4 |
aggtcgtcgggagattttaaggaaaaatccaagttcatttaacatagtatttgagttgggttaaggagttaaatagtcagatttatgtgctatatatgaa |
103 |
Q |
| |
|
|||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||| |||||||||| |||||||||||||| |
|
|
| T |
4021960 |
aggttgtcgggagattttaaggaaaaatccatgttcatttaacatagtatttgagttgggttaaggatttaaattgtcagatttaagtgctatatatgaa |
4022059 |
T |
|
| Q |
104 |
tactaa |
109 |
Q |
| |
|
|||||| |
|
|
| T |
4022060 |
tactaa |
4022065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University