View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5834-28 (Length: 94)
Name: Solexa-NF5834-28
Description: NF5834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5834-28 |
 | |
|
| [»] chr4 (3 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 69; Significance: 1e-31; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 69; E-Value: 1e-31
Query Start/End: Original strand, 14 - 94
Target Start/End: Complemental strand, 21146994 - 21146914
Alignment:
| Q |
14 |
attgacagaaaaattaaatccttgtcctattcaagttcccttgcatccagtttgccaacatctgaagtgcagcttttggtt |
94 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21146994 |
attgacagataaattaaatacttgtcctattcaagttcccatgcatccagtttgccaacatctgaagtgcagcttttggtt |
21146914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 3e-17
Query Start/End: Original strand, 12 - 94
Target Start/End: Complemental strand, 21126904 - 21126820
Alignment:
| Q |
12 |
caattgacagaaaaatt-aaatccttgtcctattcaag-ttcccttgcatccagtttgccaacatctgaagtgcagcttttggtt |
94 |
Q |
| |
|
||||||| ||||||||| |||| ||||||| || ||| ||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21126904 |
caattgaaagaaaaatttaaatgcttgtcccgttaaaggttcccatgcatccagtttgccaacatctgaagtgcagcttttggtt |
21126820 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.000000007
Query Start/End: Original strand, 52 - 94
Target Start/End: Complemental strand, 21151557 - 21151515
Alignment:
| Q |
52 |
ccttgcatccagtttgccaacatctgaagtgcagcttttggtt |
94 |
Q |
| |
|
||||||||||||||| |||||||||| | |||||||||||||| |
|
|
| T |
21151557 |
ccttgcatccagtttaccaacatctgtaatgcagcttttggtt |
21151515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University