View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5834-4 (Length: 219)
Name: Solexa-NF5834-4
Description: NF5834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5834-4 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 109; Significance: 5e-55; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 111 - 219
Target Start/End: Complemental strand, 21239583 - 21239475
Alignment:
| Q |
111 |
gtactgcatctgctccttcaacttagatctacaccatgaacaacaaagatttcacactaaatgtatgccactatcaaattaacaaaataaaaatttcaga |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21239583 |
gtactgcatctgctccttcaacttagatctacaccatgaacaacaaagatttcacactaaatgtatgccactatcaaattaacaaaataaaaatttcaga |
21239484 |
T |
|
| Q |
211 |
atatgcaaa |
219 |
Q |
| |
|
||||||||| |
|
|
| T |
21239483 |
atatgcaaa |
21239475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 1 - 102
Target Start/End: Original strand, 21239503 - 21239604
Alignment:
| Q |
1 |
taatttgatagtagcatacatttagtgtgaaatctttgttgttcatggtgtagatctaagttgaaggagcagatgcagtactgtgttgaacatccagagg |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
21239503 |
taatttgatagtggcatacatttagtgtgaaatctttgttgttcatggtgtagatctaagttgaaggagcagatgcagtactgtgttgaacacccagagg |
21239602 |
T |
|
| Q |
101 |
ag |
102 |
Q |
| |
|
|| |
|
|
| T |
21239603 |
ag |
21239604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 58 - 104
Target Start/End: Complemental strand, 7489875 - 7489829
Alignment:
| Q |
58 |
aagttgaaggagcagatgcagtactgtgttgaacatccagaggaggt |
104 |
Q |
| |
|
||||||||||||||||| ||||| ||||| |||||||| |||||||| |
|
|
| T |
7489875 |
aagttgaaggagcagatacagtattgtgtggaacatccggaggaggt |
7489829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University