View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5835-13 (Length: 141)
Name: Solexa-NF5835-13
Description: NF5835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5835-13 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 138; Significance: 2e-72; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 4 - 141
Target Start/End: Original strand, 42661500 - 42661637
Alignment:
| Q |
4 |
agaaccaacctgcaacagatgtgcgtagcttgagttgttcgaagaacaaaacttggacaacaacacgaagtggtagcctttcgttttgagctgcgtgtgt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42661500 |
agaaccaacctgcaacagatgtgcgtagcttgagttgttcgaagaacaaaacttggacaacaacacgaagtggtagcctttcgttttgagctgcgtgtgt |
42661599 |
T |
|
| Q |
104 |
gcttgcttccaatgagagtttctggcaattcatcagcc |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42661600 |
gcttgcttccaatgagagtttctggcaattcatcagcc |
42661637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University