View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5835-17 (Length: 127)
Name: Solexa-NF5835-17
Description: NF5835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5835-17 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 118; Significance: 1e-60; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 118; E-Value: 1e-60
Query Start/End: Original strand, 10 - 127
Target Start/End: Complemental strand, 42661993 - 42661876
Alignment:
| Q |
10 |
gacaaaagttgctgatttgatggatagttacttagctgaagtagcacctgatgtcaacttgaaatttccaaaatttcagtcacttgctgctgttattcct |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42661993 |
gacaaaagttgctgatttgatggatagttacttagctgaagtagcacctgatgtcaacttgaaatttccaaaatttcagtcacttgctgctgttattcct |
42661894 |
T |
|
| Q |
110 |
gattgtgctaggaccttg |
127 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
42661893 |
gattgtgctaggaccttg |
42661876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University