View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5835-19 (Length: 121)
Name: Solexa-NF5835-19
Description: NF5835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5835-19 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 73; Significance: 8e-34; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 73; E-Value: 8e-34
Query Start/End: Original strand, 37 - 121
Target Start/End: Complemental strand, 45757565 - 45757481
Alignment:
| Q |
37 |
aacctatagtgtgagtttgtggtttctttaaggggcaaaaacataccgtacgttgtgcattttcgtattcttaccaacccgagag |
121 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45757565 |
aacctacagtgtgagtttgtggtttctttaaggggcaaaaaaataccgtacgttgtgcattttcgtattcttaccaactcgagag |
45757481 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000004
Query Start/End: Original strand, 8 - 41
Target Start/End: Original strand, 12479505 - 12479538
Alignment:
| Q |
8 |
ctacaatactttgcactacaaacaatacaaacct |
41 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
12479505 |
ctacaatactttgccctacaaacaatacaaacct |
12479538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University